Diagnóstico prenatal, síndrome Freeman-Sheldon mediante ultrasonido y estudio genético. Reporte de caso / Prenatal diagnosis of Freeman-Sheldon syndrome using ultrasound and genetic testing. Case report

Objetivos: Describir un caso de diagnóstico prenatal de síndrome de Freeman-Sheldon mediante hallazgos ecográficos y secuenciación completa del exoma fetal. Materiales y métodos: Mujer de 33 años, con antecedentes de hipotiroidismo en tratamiento, a quien en semana 19 se realizó ecografía de detalle anatómico, en la cual se observaron deformidades en el feto en más de dos áreas corporales (extremidades superiores e inferiores), sugiriendo el diagnóstico de artrogriposis. Posteriormente, se brindó asesoría genética y se realizó amniocentesis en semana 20 de gestación, con análisis de la hibridación in situ por fluorescencia, seguido de secuenciación completa del exoma fetal. Este último examen permitió identificar una variante patogénica heterocigota en el gen MYH3, la cual se asocia con la artrogriposis distal tipo 2A. Conclusiones: La realización de la secuenciación completa de exoma fetal es un factor clave para identificar la mutación del gen MYH3, y confirma que las deformidades evidenciadas por ultrasonido estaban relacionadas con la artrogriposis distal tipo 2A. Es importante hacer la secuenciación de exoma fetal en fetos que muestren hallazgos de malformaciones articulares en el ultrasonido prenatal.

Objectives: To describe a case of prenatal diagnosis of Freeman-Sheldon syndrome based on ultrasound findings and complete fetal exome sequencing. Materials and methods: A 33-year-old woman currently on treatment for hypothyroidism in whom a 19-week detailed anatomical ultrasound scan showed fetal deformities in more than two body areas (upper and lower limbs), suggesting a diagnosis of arthrogryposis. Genetic counseling was provided and amniocentesis was performed at 20 weeks for fluorescence in situ hybridization (FISH) analysis and complete fetal exome sequencing, with the latter allowing the identification of a heterozygous pathogenic variant of the MYH3 gene which is associated with type 2A distal arthrogryposis. Conclusions: Complete fetal exome sequencing was a key factor in identifying the MYH3 gene mutation and confirmed that the deformities seen on ultrasound were associated with type 2A distal arthrogryposis. It is important to perform complete fetal exome sequencing in cases of joint malformations seen on prenatal ultrasound.

A Case Report of Nail-Patella Syndrome / 罕见病研究

Nail-patella syndrome (NPS) is a hereditary rare disease that can involve fingernail, patella, elbow, and iliac bones. In this article, we report a case of a girl-9 and 1 quarter years old who had asthmatic contractures in both elbows, thumbnail hypoplasia in both hands, patellar dislocation of both knees, iliac angle protrusion of both sides, and scoliosis. Whole exome sequencing suggests the presence of a LMX1B NM_002316.4:c.706G > C(p.Ala236Pro) mutation. NPS is an autosomal dominant disease associated with gene mutation of LMX1B, which can be diagnosed by combining the patient′s clinical manifestations and genetic results. The treatment now only targets on symptoms, relieving the localized severe lesion but not cure right now.

A Case of Distal Arthrogryposis Combined with Scoliosis / 罕见病研究

Distal arthrogryposis is a rare disease caused by mutations in genes encoding proteins involved in muscle fiber contraction. Its joint contracture mainly involves distal joint contracture, and scoliosis is often accompanied by pelvic tilt and abnormal lordosis.This article reviewed the clinical characteristics of a patient with distal arthrogryposis combined with scoliosis. The patient was a 14-year-old male. His back was found that uneven 6 years ago for no obvious reason, and his scoliosis was gradually worsened. The patient had flexion contractures of both hands and bilateral knees since childhood, and no special treatment was given. There was no obvious restriction in the movement of the spine, the thoracic segment was convex on the right side, and the lumbar segment was convex on the left side. The genetic diagnosis was MYL11 gene mutation, which was consistent with the clinical manifestations of distal arthrogryposis combined with scoliosis. Posterior scoliosis correction and growing rod placement were performed electively. The operation went smoothly and the trunk balance was satisfactory. The clinical characteristics of this disease are summarized to improve our understanding of the disease.

Síndrome de Freeman-Sheldon

RESUMEN Introducción: El síndrome de Freeman-Sheldon es un síndrome hereditario raro, de severidad variable que afecta principalmente la cara, manos y pies, sin preferencia de género, étnica o geográfica. Objetivo: Caracterizar clínicamente a un paciente con síndrome Freeman-Sheldon. Presentación del caso: Niña ecuatoriana de 6 años de edad, hija de madre de 43 años y padre de 42 años, la cuarta de 6 hermanos, todos sanos, no historia de consanguinidad. La cual presenta cara parecida a una máscara, ojos hundidos, puente nasal ancho, boca pequeña con apariencia de silbador, hoyuelo cutáneo en mentón en forma de H, defecto en las manos, contractura de los dedos con desviación cubital y pies equinovaro, dificultad para la marcha y baja talla. Conclusiones: El síndrome de Freeman-Sheldon es un síndrome raro que afecta principalmente la cara y las extremidades de los pacientes, cuyo diagnóstico clínico es posible luego de un examen físico exhaustivo.

ABSTRACT Introduction: Freeman-Sheldon syndrome is a rare hereditary syndrome of varying severity that mainly affects the face, hands and feet, without gender, ethnic or geographical preference. Objective: Clinically characterize a patient with Freeman-Sheldon syndrome. Presentation of the case: Ecuadorian girl, 6 years old, daughter of mother of 43 years and father of 42 years, the fourth of 6 brothers, all healthy, not history of consanguinity. She presents mask-like face, sunken eyes, wide nasal bridge, small mouth with the appearance of a whistler, skin dimple on the chin in the shape of an H, defect in the hands, contracture of the fingers with ulnar deviation and clubfoot, also walking difficulty and short height. Conclusions: Freeman-Sheldon syndrome is a rare syndrome that mainly affects the face and limbs of patients, whose clinical diagnosis is possible after a thorough physical examination.

RADIOGRAPH BASED DIAGNOSIS OF ARTHROGRYPOSIS MULTIPLEX CONGENITA

Arthrogryposis multiplex congenita (AMC) is a rare disorder, presenting with multiple contractures and limb deformities.Various theories have been proposed for the development of this congenital anomaly. The final diagnosis is made based upon the clinical signs and imaging findings. This case report aims to outline the imaging features that can help radiologists to make the diagnosis of AMC through radiographs and skeletal survey. Since, very few cases have been reported in literature, no specific treatment protocols have been outlined. Therefore, antenatal diagnosis based on characteristic imaging findings is crucial for early termination and parental counselling.

Artrogriposis múltiple congénita. Caso clínico

RESUMEN La artrogriposis múltiple congénita es una enfermedad de baja frecuencia, esporádica, no progresiva, que aparece en el período prenatal y se caracteriza por varias contracturas articulares presentes al nacimiento en los cuatro miembros. Se estima una incidencia de 1/10 000 nacidos vivos. El diagnóstico es posible al realizar los ultrasonidos en un feto que tiene posiciones viciosas y que no se mueve. La prevalencia de la artrogriposis múltiple congénita es variable, resultando la más frecuente la artrogriposis múltiple clásica (amioplasia), presente entre el 40 y el 50 % de los afectados. La búsqueda ultrasonográfica en el tercer trimestre del embarazo es fundamental con fines diagnósticos, para brindar asesoramiento genético y preparar un equipo para el nacimiento. Es importante tener sospecha diagnóstica para sugerir la vía alta por cesárea, para bienestar fetal. Un grupo multidisciplinario debe llevar a cabo el manejo y tratamiento de estos enfermos. Se presenta el caso de un neonato nacido a las 39 semanas por parto eutócico prolongado por presentación de cara, con sufrimiento fetal agudo, meconio ++++, apgar 5-7, con peso de 3 300 g, que presentó luxación y contractura generalizada de hombros, codos, así como de caderas, rodillas y tobillos, con dedos de manos y pies en flexión.

ABSTRACT Congenital multiple arthrogryposis is a low-frequency, sporadic, non-progressive disease that appears in the prenatal period, and is characterized by several contractures present at birth in the four limbs. The estimated incidence is 1/10 000 born alive. The diagnosis is possible performing ultrasounds on a fetus that has vicious positions and does not move. The prevalence of congenital multiple arthrogryposis is variable, being classical multiple arthrogryposis (amyoplasia) the most frequent one, present in between 40 and 50 % of the affected persons. Ultrasonographic search in the third semester of pregnancy is essential for diagnostic purposes to provide genetic counseling and to prepare a ream for birth. It is important to have diagnostic suspicion to suggest the high cesarean way for fetal well-being. A multidisciplinary group should carry out the management and treatment of these patients. The case of a newborn is presented, who was born at 39 weeks by prolonged eutocic delivery due to presenting face, with acute fetal suffering, meconium ++++, apgar 5-7, weighing 3 300 g, that presented luxation and general contracture of shoulders, elbows, and also hips, knees and ankles, with fingers and toes in flexion.

Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination / 中华围产医学杂志

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Fetal akinesia deformation sequence with pontocerebellar hypoplasia, and migration and gyration defects

Fetal akinesia deformation sequence (FADS), or Pena-Shokeir phenotype is a constellation of deformational changes resulting from decreased or absent fetal movement, and include arthrogryposis, and craniofacial and central nervous system anomalies. We report an autopsy case of a 36-6/7week female neonate with a normal female karyotype and chromosome microarray demonstrating findings consistent with FADS. We provide a detailed examination of the severe and complex central nervous system abnormalities, including marked pontocerebellar hypoplasia and cortical and cerebellar migration and gyration defects. This case represents a rare detailed examination of the central nervous system of a patient with FADS.

Congenital hyperextension deformity of the knees due to arthrogryposis multiplex congenita? case report

ABSTRACT Introduction: Arthrogryposis multiplex congenita is a disorder characterized by non-progressive joint contractures. It has an estimated prevalence of 1 in every 3 000-5 000 live births, with the same male-to-female ratio. Case presentation: This is the case of a male newborn with adequate prenatal care checkup appointments, who presented with a congenital deformity of the lower limbs. On physical examination, he had hyperextension of the knees (passive flexion of 20° in the left leg and 30° in the right leg), and painful active movement. On admission, peripheral pulses had good intensity, and adequate distal perfusion was found. Barlow and Ortolani maneuvers were negative, and no midline lesions were observed in the spine. The patient was diagnosed with arthrogryposis multiplex congenita and received multidisciplinary treatment to avoid early morbidity and mortality. Conclusion: To attain satisfactory clinical development in patients with arthrogryposis, it is essential to have a high level of antenatal suspicion, as well as appropriate prenatal checkups. All this allows for proper management, minimizing diagnostic errors, avoiding unnecessary procedures, and performing effective and timely treatment with outstanding results.

RESUMEN Introducción. La artrogriposis múltiple congénita es un desorden caracterizado por contracturas articulares no progresivas y que tiene una prevalencia estimada de 1 caso por cada 3 000-5 000 nacidos vivos con igual proporción entre géneros. Presentación del caso. Paciente masculino recién nacido con adecuados controles prenatales, quien al nacimiento presentó deformidad en miembros inferiores debido a hiperextensión de las rodillas (flexión pasiva de 20° en pierna izquierda y 30° en pierna derecha) que provocaba dolor a la movilización activa. Al ingreso se registró perfusión distal adecuada y pulsos periféricos simétricos y de buena intensidad; las maniobras de Ortolani y Barlow fueron negativas y no se evidenciaron lesiones en la línea media del dorso. El paciente fue diagnosticado con artrogriposis múltiple congénita y recibió tratamiento multidisciplinario que evitó morbi-mortalidad temprana. Conclusión. La sospecha prenatal, el examen físico exhaustivo y el diagnóstico diferencial son de vital importancia para lograr una evolución clínica satisfactoria en la artrogriposis múltiple congénita; con esto es posible hacer un manejo adecuado, minimizar los errores diagnósticos, evitar procedimientos innecesarios y realizar un tratamiento efectivo y oportuno con excelentes resultados.

Arthrogryposis multiplex congenita in Aberdeen Angus cattle in Uruguay / Artrogripose múltipla congênita em bovinos Aberdeen Angus no Uruguai

Arthrogryposis multiplex congenita is reported for the first time in the Aberdeen Angus (AA) breed in Uruguay. In a commercial herd of 30 purebred Aberdeen Angus cows, two calves with severe musculoskeletal malformations died at birth. The cows had been inseminated using semen imported from Argentina from one elite AA sire only. At necropsy, one calf showed severe muscular atrophy, arthrogryposis affecting all four limbs and the spine, kyphoscoliosis and torticollis. Histopathology showed muscular atrophy with marked fiber size variation and abundant fibroadipose fibers. The central nervous system only showed congestion and edema due to dystocia, whereas the peripheral nerves and the number of motor neurons in the spinal appeared normal. DNA analysis confirmed arthrogryposis multiplex congenita. It is concluded that disease in Aberdeen Angus cattle is due to failure in the neuromuscular junction.(AU)

Artrogripose múltipla congênita é relatada pela primeira vez em bovinos Aberdeen Angus (AA) no Uruguai. Num rebanho comercial de 30 vacas a Aberdeen Angus, dois bezerros com graves malformações musculoesqueléticas morreram logo após o nascimento. As vacas foram inseminadas utilizando sêmen importado da Argentina, de apenas um touro de elite de AA. Na necropsia, um dos bezerros apresentava atrofia muscular grave, artrogripose afetando todos os quatro membros e a coluna vertebral, cifoscoliose e torcicolo. A histopatologia demonstrou atrofia muscular com acentuadas variações no tamanho das fibras e abundantes fibras fibroadiposas. O sistema nervoso central apresentava apenas congestão e edema devido à distocia, enquanto os nervos periféricos e o número de neurônios motores na medula espinhal pareciam normais. A análise de DNA confirmou artrogripose múltipla congênita. Concluiu-se que a doença em bovinos Aberdeen Angus se deve a falha na junção neuromuscular.(AU)

Síndrome congénito asociado a virus Zika

La infección por el virus Zika (ZIKV) inicialmente descrita como una enfermedad febril leve, hoy se conoce por estar asociada a malformaciones congénitas, destacando la microcefalia. En Venezuela son poco los datos registrados, por lo que se plantea la realización de un estudio para describir el comportamiento de la enfermedad congénita en la población venezolana. Metodología: Se realizó un estudio prospectivo, observacional, se incluyeron todos los niños que acudieron a la consulta de Infectología Pediátrica del Hospital Universitario de Caracas entre agosto de 2016 y marzo de 2018 con diagnóstico de microcefalia y/o aquellos con exposición sospechada o confirmada al virus Zika durante la gestación, siendo evaluados mediante examen físico y estudios paraclínicos. Todos los pacientes fueron evaluados por equipo multidisciplinario. Resultados: Se incluyeron 28 pacientes, prevaleciendo el sexo femenino con 53,6 %, el 60,7 % de los pacientes presentaron microcefalia. Se observaron malformaciones esqueléticas: artrogriposis, pie equinovaro, pie valgo, afecciones oculares: endotropía, catarata congénita, leucocoria bilateral, microftalmia. En el 28,6 % de pacientes no se evidenciaron malformaciones. Se observaron casos confirmados para Zika, con microcefalia y TAC de cráneo con ventriculomegalia, así como pacientes con circunferencia cefálica (CC) normal y estudios de imagen sin alteraciones. Se reportan 2 casos con CC normal al nacimiento y progresión a microcefalia en consultas sucesivas. Conclusiones: El virus Zika se encuentra asociado con síndrome genético caracterizado por microcefalia, malformaciones musculoesqueléticas y oftalmológicas. La microcefalia en la infección por virus Zika se puede desarrollar en el período postnatal.

The Zika virus infection (ZIKV) initially described as a mild febrile disease, is now known to be associated with congenital malformations, highlighting microcephaly. In Venezuela there is little data recorded, so it is proposed to conduct a study to describe the behavior of congenital disease in the Venezuelan population. Methodology: A prospective, observational study was carried out, including all children who attended the Pediatric Infectious Disease consultation at the University Hospital of Caracas between August 2016 and March 2018 with a diagnosis of microcephaly and / or those with suspected or confirmed exposure to the Zika virus during pregnancy, being evaluated by physical examination and paraclinical studies. All patients were evaluated by a multidisciplinary team. Results: Twenty-eight patients were included, prevailing the female gender with 53.6 %, 60.7 % of the patients presented microcephaly. Skeletal malformations were observed: arthrogryposis, equinovar foot, valgus foot, ocular affections: endotropia, congenital cataract, bilateral leukocoria, microphthalmia. In 28.6 % of patients, malformations were not observed. Confirmed cases were observed for Zika, with microcephaly and TAC of the skull with ventriculomegaly, as well as patients with normal cephalic circumference (cc) and imaging studies without alterations. Two cases are reported with normal CC at birth and progression to microcephaly in successive consultations. Conclusions: The Zika virus is associated with a genetic syndrome characterized by microcephaly, musculoskeletal and ophthalmological malformations. Microcephaly in Zika virus infection can develop in the postnatal period.

Open quadricepsplasty in hyperextension deformity of knee in children with arthrogryposis

Arthrogryposis includes heterogeneous disorders, characterized by congenital contractures of multiple joints. Knee involvement is very common (38–90 % of patients with amyoplasia) ranging from soft-tissue contractures (in flexion or hyperextension) to subluxation and dislocation. Children who present late will require surgery involving quadricepsplasty or lengthening of the contracted quadriceps muscle. Curtis and Fisher describe an open V-Y lengthening of the quadriceps femoris with post-operative immobilization in 30-45 ° of flexion. The main issue of this technique was limited degree of flexion that can be achieved, and the fibrous replacement of the quadriceps muscle. This is a neglected case of hyperextension deformity and congenital dislocation of knee in children with arthrogryposis resistant to conservative management and successfully treated by open quadricepsplasty.

Diagnostic value of radiography for intra-articular fracture of distal radius with wrist instability / 中国基层医药

Objective@#To study the clinical value of radiographic diagnosis of intra-articular fractures of distal radius with instability of wrist joint.@*Methods@#From July 2017 to June 2018, 72 patients with intra-articular fracture of distal radius with wrist instability in Yiwu Central Hospital were divided into two groups according to random digital table, with 36 patients in each group.The control group was examined by X-ray.The observation group was diagnosed by X-ray and CT.The results of diagnosis and treatment of intra-articular fracture of distal radius with wrist instability were compared between the two groups.@*Results@#In the observation group, the detection rates of the radius shortened(58.33%), the ulnar angle changed(86.11%), the dorsal articular surface compressed and collapsed(83.33%), the articular surface separated(77.78%), the bone mass of the articular surface more than 3 (63.89%), fracture with ulnar subluxation (69.44%) were higher than those of the control group(33.33%, 58.33%, 61.11%, 52.78%, 41.67%, 44.44%), the differences were statistically significant(χ2=4.532, 6.923, 4.431, 4.963, 4.531, 4.589, all P<0.05). The 1-month recovery rate(88.89%) and 2-month recovery rate(94.44%) in the observation group were higher than those in the control group(69.44%, 77.78%), the differences were statistically significant(χ2 =4.126, 4.181, all P<0.05).@*Conclusion@#The combined use of X-ray and CT in the diagnosis of intraarticular fracture of distal radius with instability of wrist joint has a higher diagnostic accuracy and can provide valuable reference for clinical treatment.

Diagnostic value of radiography for intra-articular fracture of distal radius with wrist instability / 中国基层医药

Objective To study the clinical value of radiographic diagnosis of intra-articular fractures of distal radius with instability of wrist joint.Methods From July 2017 to June 2018,72 patients with intra-articular fracture of distal radius with wrist instability in Yiwu Central Hospital were divided into two groups according to random digital table,with 36 patients in each group.The control group was examined by X-ray.The observation group was diagnosed by X-ray and CT.The results of diagnosis and treatment of intra-articular fracture of distal radius with wrist instability were compared between the two groups.Results In the observation group,the detection rates of the radius shortened (58.33 ％),the ulnar angle changed (86.11％),the dorsal articular surface compressed and collapsed(83.33％),the articular surface separated(77.78％),the bone mass of the articular surface more than 3 (63.89％),fracture with ulnar subluxation (69.44％) were higher than those of the control group (33.33％,58.33％,61.11％,52.78％,41.67％,44.44％),the differences were statistically significant(x2 =4.532,6.923,4.431,4.963,4.531,4.589,all P ＜ 0.05).The 1-month recovery rate (88.89％) and 2-month recovery rate (94.44％) in the observation group were higher than those in the control group(69.44％,77.78％),the differences were statistically significant (x2 =4.126,4.181,all P ＜ 0.05).Conclusion The combined use of X-ray and CT in the diagnosis of intraarticular fracture of distal radius with instability of wrist joint has a higher diagnostic accuracy and can provide valuable reference for clinical treatment.

Congenital abnormalities and arthrogryposis in newly born lambs in Al Muthanna province Iraq. Suspicion of Akabane virus infection / Anormalidades congênitas e artrogripose em cordeiros recém-nascidos na província de Al Muthanna, Iraque. Suspeita de infecção pelo vírus Akabane

Akabane virus, a member of the Orthobunyavirus genus in the family Bunyaviridae, causes congenital abnormalities and arthrogryposis with hydrocephalus or hydroencephaly in ruminants. This study intends to describe the clinical signs, gross and histopathological features seen in 25 affected lambs in an outbreak of congenital arthrogryposis with hydrocephalus or hydranencephaly in Al-Muthanna governorate, Iraq after a large number of stillbirths and musculoskeletal deformities from October 2017 to May 2018. Skeletal muscle hypoplasia was seen in the limbs of the affected lambs accompanied with severe arthrogryposis and gross visible brain malformations. In addition, fetal mummifications, stillbirths, and dead lambs were also seen. The most histopathological features in muscle fibers were degenerative lesions and absences of cross-striation accompanied with mild infiltration of neutrophils and mononuclear cells in severely affected lambs. The meninges of affected lambs revealed fused membranes with focal areas of fibrous thickenings and necrotic debris. In conclusion, according to clinical signs, gross and histopathological investigations, Akabane virus, a member of the Orthobunyavirus genus in the family Bunyaviridae, causes congenital abnormalities and arthrogryposis with hydrocephalus or hydroencephaly in ruminants and could be the cause of this outbreak, although future studies must be performed to confirm the etiology of this outbreak. Moreover, other causes of hydrocephalus or cerebellar malformation, such as Schmallenberg virus, bluetongue virus and border disease virus and teratogenic plants that lead to arthrogryposis, have to be investigated. Also, the authorities should take prevention and control measurements to stop the replication of arthropod vectors.(AU)

O presente trabalho descreve os sinais clínicos, as lesões macroscópicas e os aspectos histológicos observados em 25 cordeiros acometidos em um surto de artrogripose congênita com hidrocéfalo ou hidrocefalia registrado no Iraque, governadoria Al-Muthama após a ocorrência de nascimentos prematuros e deformidades músculo-esqueléticas no período compreendido entre outubro de 2017 e maio de 2018. A hipoplasia músculo-esquelética foi observada nos membros dos cordeiros afetados, acompanhada de severa artrogripose e malformações cerebrais, grosseiras visíveis, além de mumificações fetais, nascimentos prematuros e morte de cordeiros. Os principais aspectos histopatológicos nas fibras musculares foram lesões degenerativas e ausências da estriação cruzada acompanhada de leve infiltração de neutrófilos e células mononucleares dos cordeiros severamente afetados. As meninges dos cordeiros afetados apresentaram fusão de membranas com áreas focais de espessamento fibroso e debris necróticos. O vírus Akabane, um membro do gênero Orthobunyavirus, da família Bunyaviridae, causa anormalidades congênitas e artrogripose com hidrocéfalo e hidrocefalia em ruminantes e poderá vir a ser a causa do presente surto. Os autores recomendam a realização de novos estudos com investigações epidemiológicas e isolamento do agente causal. Contudo, outras causas de hidrocéfalo ou malformações cerebrais como as determinadas pelo vírus Schmallenberg, vírus da língua azul e vírus da doença de border, bem como de plantas teratogênicas que determinam a artrogripose, também deverão ser investigadas. As autoridades sanitárias deverão tomar medidas de prevenção e controle para bloquear a replicação do vírus em artrópodes vetores.(AU)

Tratamiento y desenlace obstétrico de una paciente con artrogriposis múltiple congénita / Clinical treatment and outcome of a patient with arthrogryposis multiplex congenita

Resumen ANTECEDENTES: La artrogriposis múltiple congénita es una alteración excepcional, caracterizada por contracturas musculares en diversas partes del cuerpo. Las pacientes embarazadas con esta enfermedad tienen mayor riesgo de complicaciones obstétricas. CASO CLÍNICO: Paciente de 19 años, con artrogriposis múltiple congénita, de ocho semanas de embarazo, quien acudió al servició médico para iniciar el control prenatal. Recibió asesoría de los riesgos cardiovasculares y del sistema respiratorio, secundarios a la enfermedad de base, que pudieran exacerbarse por el embarazo. El ultrasonido efectuado en la semana 22 del embarazo no reportó alteraciones estructurales. La paciente continuó en control prenatal, sin dificultad respiratoria ni alteraciones cardiovasculares. No recibió anticoagulantes profilácticos, ni manifestó signos de trombosis durante el embarazo. Se decidió la interrupción del embarazo por cesárea, debido a la limitación del movimiento de la cadera. Se programó para cirugía en la semana 38.3 del embarazo, con valoración del servicio de Cardiología, quienes reportaron fracción de eyección del ventrículo izquierdo adecuada y sin evidencia de miocardiopatía. Se aplicó anestesia por vía epidural sin complicaciones. El examen físico del neonato no mostró alteraciones. Actualmente, la madre y su hijo permanecen con buen estado de salud. CONCLUSIONES: Las pacientes embarazadas con artrogriposis múltiple congénita deben recibir asesoría de los riesgos inherentes y posibles complicaciones de la enfermedad. Es importante la intervención de un equipo multidisciplinario, para evaluar la función cardiovascular y respiratoria, además de efectuar revisiones seriadas para asegurar el bienestar materno-fetal.

Abstract BACKGROUND: Arthrogryposis multiplex congenita is a rare entity characterized by the appearance of multiple muscle contractures in various parts of the body. Pregnant patients with this condition have a higher risk of complications in obstetric management. CLINICAL CASE: A 19-year-old patient, with arthrogryposis multiplex congenita, eight weeks pregnant, attended in medical service to start prenatal care. Received advice on the cardiovascular and respiratory system risks, secondary to the underlying disease, that could be exacerbated by pregnancy. The ultrasound during the 22nd week of pregnancy did not report any structural alterations. The patient continued in prenatal control, without respiratory difficulty or cardiovascular alterations. Did not receive prophylactic anticoagulants, neither showed signs of thrombosis. We decide finished the pregnancy by caesarean section, due to the limited movement of the hip. Surgery was scheduled at week 38.3 of pregnancy, with assessment by the Cardiology service, who reported adequate left ventricular ejection fraction and no evidence of cardiomyopathy. Epidural anesthesia was applied without complications. The physical examination of the newborn showed no alterations. Currently, the mother and her son remain in good health. CONCLUSIONS: In pregnant patients with arthrogryposis multiplex congenita its important to explain the inherent risks of their condition and their possible complications. Multidisciplinary management should be performed with cardiovascular, respiratory, and serial reviews to ensure the welfare of the maternal-fetal binomial.

Biplanar carpal wedge osteotomy in the treatment of the arthrogrypotic patients / Osteotomia intracárpica biplanar no tratamento de pacientes com artrogripose

ABSTRACT Objective: To describe the results of the surgical treatment of patients with congenital arthrogryposis with wrist deformity through biplanar carpal wedge osteotomy. Method: This study analyzed nine patients through a retrospective evaluation with severe deformity in flexion and ulnar deviation of the wrist in the period between January 2004 and December 2009. They were submitted to carpal osteotomy with a biplanar dorsal resection wedge, with a minimum evaluation of 48 months of postoperative evolution. In three patients the osteotomy was bilateral, totalling 12 cuffs analyzed. The indication for the technique described was deformity and stiffness for over six months, without improvement with the conservative treatment. Results: The mean age of the patients on the day of surgery was five years and eight months. The initial mean wrist mobility was 35°, and the joints presented a mean flexion of 72.5° in a resting position. Osteotomy union occurred in all patients at an average period of 5.7 weeks. The final position of the resting wrist was 12° of flexion and the mean mobility was 26.6°, slightly lower than preoperatively but in a much better position. No serious complications arising from surgery or in the immediate postoperative period were observed. Conclusions: Carpal osteotomy with biplanar dorsal resection wedge was useful and effective in helping to correct the deformities in flexion and ulnar deviation of the wrist, maintaining a reasonable mobility. It is a preservation surgery, which has low morbidity and avoids the progression of deformity and future degenerative changes.

RESUMO Objetivo: Descrever os resultados do tratamento cirúrgico de pacientes portadores de artrogripose congênita com deformidade do punho através da osteotomia intracárpica biplanar. Método: Por meio de uma avaliação retrospectiva, entre janeiro de 2004 e dezembro de 2009, o estudo avaliou nove pacientes com grave deformidade em flexão e desvio ulnar do punho por artrogripose submetidos a osteotomia intracárpica com cunha de ressecção dorsal biplanar, com avaliação mínima de 48 meses de evolução pós-operatória. Em três pacientes, a osteotomia foi bilateral, perfez 12 punhos analisados. A indicação da técnica descrita foi deformidade e rigidez havia mais de seis meses, sem melhoria com tratamento conservador. Resultados: A média de idade dos pacientes no dia da cirurgia foi de cinco anos e oito meses. A média de mobilidade inicial do punho foi de 35° e as articulações apresentavam 72,5° de flexão média em posição de repouso. Todas osteotomias consolidaram em um período médio de 5,7 semanas. A média da posição final do punho em repouso foi de 12° de flexão e a mobilidade média foi de 26,6°, ligeiramente inferior ao pré-operatório, porém mais bem posicionado. Não foram observadas complicações graves decorrentes da cirurgia ou no pós-operatório imediato. Conclusões: A osteotomia intracárpica com cunha de ressecção dorsal biplanar se mostrou útil e eficaz no auxílio da correção da deformidade em flexão e desvio ulnar do punho, com manutenção de uma mobilidade razoável. É uma cirurgia preservadora, com baixa morbidade e que evita a progressão da deformidade e alterações degenerativas futuras.

Abortos, malformações congênitas e falhas reprodutivas espontâneas em caprinos causados na intoxicação pelas folhas da catingueira, Poincianella pyramidalis (sin. Caesalpinia pyramidalis) / Spontaneous abortion, congenital malformation and reproductive losses in goats due to poisoning by the leaves of Poincianella pyramidalis (syn. Caesalpinia pyramidalis)

O objetivo deste estudo foi investigar os efeitos de folhas da espécie arbórea Poincianella pyramidalis (Tul.) L.P. Queiroz como causa espontânea de abortos, malformações e falhas reprodutivas em rebanhos caprinos no semiárido brasileiro. Foram realizadas investigações epidemiológicas, avaliações clínicas de caprinos acometidos por malformações e necropsias de fetos abortados em 12 propriedades localizadas nos municípios de Gurjão e Soledade, na Paraíba, e no município de Pau dos Ferros, Rio Grande do Norte. O estudo considerou apenas as propriedades que tinham basicamente a presença de P. pyramidalis entre as plantas teratogênicas. Na propriedade localizada no município de Pau dos Ferros foi verificada a ocorrência de grande número de abortos e o nascimento de cabritos malformados, acometendo 90% das cabras gestantes. Nas 12 propriedades pertencentes aos municípios de Gurjão e Soledade na Paraíba os casos espontâneos de mortalidade embrionária, abortos e malformações acometeram 257 cabras (41,1% das cabras dos rebanhos). A artrogripose foi a principal malformação congênita observada. Exames de necropsia e histopatológico de quatro fetos acompanhados das placentas não constataram a presença de agentes infecciosos. Os casos de perda embrionária, abortos e malformações foram concentrados predominantemente nas épocas do ano em que a pastagem estava escassa, mas havia disponibilidade de P. pyramidalis nas propriedades, devido à ocorrência das chuvas da pré-estação, que não permitiu a germinação de pasto, mas a rebrotação de P. pyramidalis. Os achados desse estudo comprovam que esta planta interfere consideravelmente na eficiência reprodutiva dos rebanhos caprinos do Semiárido.(AU)

The aim of this study was to investigate the effects of the leaves of the tree Poincianella pyramidalis (Tul.) L.P. Queiroz as a spontaneous cause of abortion, malformation and reproductive failure in goat herds in the Brazilian semiarid region. Epidemiological investigations, clinical evaluation of goats affected by malformation and necropsy of aborted fetuses was carried out on 12 farms located in the municipalities of Gurjão and Soledade, state of Paraíba, and on a farm located at the municipality of Pau dos Ferros, state of Rio Grande do Norte. The study considered only the farms where occurred predominantly P. pyramidalis among teratogenic plants. On the farm located in the municipality of Pau dos Ferros the occurrence of frequent abortion and birth of malformed goats, affecting 90% of pregnant goats, was observed. On the 12 farms belonging to the municipalities of Gurjão and Soledade, spontaneous cases of embryonic mortality, abortion and malformation occurred in 257 goats (41.1% of goats). Arthrogryposis was the main congenital malformation observed. Necropsy and histopathological exams of four fetuses and their placentas did not detect the presence of infectious agents. The cases of embryonic mortality, abortion and malformation were predominantly concentrated during the seasons of the year when pasture was scarce, but P. pyramidalis was available, due to the occurrence of pre-seasonal rains, which did not allow the pasture to germinate but P. pyramidalis to regrowth. The findings of this study confirm that this plant significantly interferes in the reproductive efficiency of semi-arid goat herds.(AU)

Paciente con asociación de síndrome uña-rótula y artrogriposis múltiple congénita. Evolución clínico-radiológica / Patient with association of nail-patella syndrome and multiple congenital arthrogryposis. Clinical radiological evolution

RESUMEN La asociación de la artrogriposis múltiple congénita con el síndrome uña -rótula es rara, porque ambas patologías son infrecuentes. Debido a la gran variedad de manifestaciones clínico-radiológica de ambos síndromes, es necesario conocer el cuadro clínico de cada una de ellas para poder identificar el origen de todas las afectaciones encontradas en el paciente, una vez alcanzada la adultez. Se presentó un paciente adulto tratado durante su infancia en el Hospital Pediátrico “Eliseo Noel Caamaño”, de Matanzas, con la asociación de ambas entidades, con el fin de observar su estado anatómico, funcional y radiológico actual. El objetivo fue estudiar la evolución clínico-radiológica del paciente a través del tiempo. Se concluyó que en este tipo de patologías se producen severas deformidades del Sistema Osteomioarticular, así como de otros sistemas, por lo que se requiere de un trabajo multidisciplinario y de un estricto seguimiento para lograr personas útiles a la sociedad a pesar de sus limitaciones físicas... (AU)

ABSTRACT The association of multiple congenital arthrogryposis with nail-patella syndrome is rare, because both pathologies are infrequent. Due to the great range of clinical radiological manifestations of both syndromes, it is necessary to know the clinical characteristics of each of them to identify the origin of these affections found in the patient after reaching the adulthood. It is presented an adult patient treated during the childhood in the Pediatric Hospital ¨Eliseo Noel Caamaño¨, of Matanzas, with the association of both entities, to observe his current anatomic, functional and radiological status. The aim was studying the patient´s clinical radiological evolution through the time. The conclusion we arrived at was that this kind of pathologies produce severe deformities of the Osteomyoarticular System and also of other systems, so it is required a multidisciplinary approach and a strict follow-up to offer the society useful persons in spite of their physical limitations...(AU)